Examples
The following DNA sequences illustrate pair double-stranded patterns. By convention, the top strand is written from the 5' end to the 3' end; thus, the bottom strand is written 3' to 5'.
- A base-paired DNA sequence:
ATCGATTGAGCTCTAGCGTAGCTAACTCGAGATCGC
- The corresponding RNA sequence, in which uracil is substituted for thymine where uracil takes its place in the RNA strand:
AUCGAUUGAGCUCUAGCGUAGCUAACUCGAGAUCGC
Read more about this topic: Base Pair
Famous quotes containing the word examples:
“In the examples that I here bring in of what I have [read], heard, done or said, I have refrained from daring to alter even the smallest and most indifferent circumstances. My conscience falsifies not an iota; for my knowledge I cannot answer.”
—Michel de Montaigne (15331592)
“It is hardly to be believed how spiritual reflections when mixed with a little physics can hold peoples attention and give them a livelier idea of God than do the often ill-applied examples of his wrath.”
—G.C. (Georg Christoph)
“Histories are more full of examples of the fidelity of dogs than of friends.”
—Alexander Pope (16881744)