Examples
The following DNA sequences illustrate pair double-stranded patterns. By convention, the top strand is written from the 5' end to the 3' end; thus, the bottom strand is written 3' to 5'.
- A base-paired DNA sequence:
ATCGATTGAGCTCTAGCGTAGCTAACTCGAGATCGC
- The corresponding RNA sequence, in which uracil is substituted for thymine where uracil takes its place in the RNA strand:
AUCGAUUGAGCUCUAGCGUAGCUAACUCGAGAUCGC
Read more about this topic: Base Pair
Famous quotes containing the word examples:
“In the examples that I here bring in of what I have [read], heard, done or said, I have refrained from daring to alter even the smallest and most indifferent circumstances. My conscience falsifies not an iota; for my knowledge I cannot answer.”
—Michel de Montaigne (15331592)
“No rules exist, and examples are simply life-savers answering the appeals of rules making vain attempts to exist.”
—André Breton (18961966)
“There are many examples of women that have excelled in learning, and even in war, but this is no reason we should bring em all up to Latin and Greek or else military discipline, instead of needle-work and housewifry.”
—Bernard Mandeville (16701733)