Telomere Sequences
Known, up-to-date telomere nucleotide sequences are listed in TelomereDB website.
| Group | Organism | Telomeric repeat (5' to 3' toward the end) |
|---|---|---|
| Vertebrates | Human, mouse, Xenopus | TTAGGG |
| Filamentous fungi | Neurospora crassa | TTAGGG |
| Slime moulds | Physarum, Didymium | TTAGGG |
| Dictyostelium | AG(1-8) | |
| Kinetoplastid protozoa | Trypanosoma, Crithidia | TTAGGG |
| Ciliate protozoa | Tetrahymena, Glaucoma | TTGGGG |
| Paramecium | TTGGG(T/G) | |
| Oxytricha, Stylonychia, Euplotes | TTTTGGGG | |
| Apicomplexan protozoa | Plasmodium | TTAGGG(T/C) |
| Higher plants | Arabidopsis thaliana | TTTAGGG |
| Green algae | Chlamydomonas | TTTTAGGG |
| Insects | Bombyx mori | TTAGG |
| Roundworms | Ascaris lumbricoides | TTAGGC |
| Fission yeasts | Schizosaccharomyces pombe | TTAC(A)(C)G(1-8) |
| Budding yeasts | Saccharomyces cerevisiae | TGTGGGTGTGGTG (from RNA template) or G(2-3)(TG)(1-6)T (consensus) |
| Saccharomyces castellii | TCTGGGTG | |
| Candida glabrata | GGGGTCTGGGTGCTG | |
| Candida albicans | GGTGTACGGATGTCTAACTTCTT | |
| Candida tropicalis | GGTGTAGGATGTCACGATCATT | |
| Candida maltosa | GGTGTACGGATGCAGACTCGCTT | |
| Candida guillermondii | GGTGTAC | |
| Candida pseudotropicalis | GGTGTACGGATTTGATTAGTTATGT | |
| Kluyveromyces lactis | GGTGTACGGATTTGATTAGGTATGT |
Read more about this topic: Telomere