Example
For example, consider the following two rounds of shotgun reads:
| Strand | Sequence |
|---|---|
| Original | AGCATGCTGCAGTCATGCTTAGGCTA |
| First shotgun sequence | AGCATGCTGCAGTCATGCT------- |
| Second shotgun sequence | AGCATG-------------------- |
| Reconstruction | AGCATGCTGCAGTCATGCTTAGGCTA |
In this extremely simplified example, none of the reads cover the full length of the original sequence, but the four reads can be assembled into the original sequence using the overlap of their ends to align and order them. In reality, this process uses enormous amounts of information that are rife with ambiguities and sequencing errors. Assembly of complex genomes is additionally complicated by the great abundance of repetitive sequence, meaning similar short reads could come from completely different parts of the sequence.
Many overlapping reads for each segment of the original DNA are necessary to overcome these difficulties and accurately assemble the sequence. For example, to complete the Human Genome Project, most of the human genome was sequenced at 12X or greater coverage; that is, each base in the final sequence was present, on average, in 12 reads. Even so, current methods have failed to isolate or assemble reliable sequence for approximately 1% of the (euchromatic) human genome.
Read more about this topic: Shotgun Sequencing
Famous quotes containing the word example:
“Our intellect is not the most subtle, the most powerful, the most appropriate, instrument for revealing the truth. It is life that, little by little, example by example, permits us to see that what is most important to our heart, or to our mind, is learned not by reasoning but through other agencies. Then it is that the intellect, observing their superiority, abdicates its control to them upon reasoned grounds and agrees to become their collaborator and lackey.”
—Marcel Proust (18711922)