Replisome - Solving The Challenges of DNA Replication - Priming The Leading and Lagging Strands

Priming The Leading and Lagging Strands

From both a structural and chemical perspective, a single strand of DNA by itself (and the associated single strand binding proteins) is not suitable for polymerisation. This is because the chemical reactions catalysed by replicative polymerases require a free 3' OH in order to initiate nucleotide chain elongation. In terms of structure, the conformation of replicative polymerase active sites (which is highly related to the inherent accuracy of replicative polymerases) means these factors cannot start chain elongation without a pre-existing chain of nucleotides, because no known replicative polymerase can start chain elongation de novo.

Priming enzymes, (which are DNA-dependent RNA polymerases), solve this problem by creating an RNA primer on the leading and lagging strands. The leading strand is primed once, and the lagging strand is primed approximately every 1000 (+/- 200) base pairs (one primer for each Okazaki fragment on the lagging strand). Each RNA primer is approximately 10 bases long.

Single strand of DNA with strand binding proteins (*) and RNA primer added by priming enzymes (UAGCUAUAUAUA).
=========================================== Sugar phosphate backbone
ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Lagging strand bases
UAGCUAUAUAUA******************************* RNA primer and strand binding proteins

The interface at (A*) contains a free 3' OH that is chemically suitable for the reaction catalysed by replicative polymerases, and the "overhang" configuration is structurally suitable for chain elongation by a replicative polymerase. Thus, replicative polymerases can begin chain elongation at (A*).

Read more about this topic:  Replisome, Solving The Challenges of DNA Replication

Famous quotes containing the words leading, lagging and/or strands:

    The clergyman is expected to be a kind of human Sunday. Things must not be done in him which are venial in the week-day classes. He is paid for this business of leading a stricter life than other people. It is his raison d’ĂȘtre.... This is why the clergyman is so often called a “vicar”Mhe being the person whose vicarious goodness is to stand for that of those entrusted to his charge.
    Samuel Butler (1835–1902)

    Already nature is serving all those uses which science slowly derives on a much higher and grander scale to him that will be served by her. When the sunshine falls on the path of the poet, he enjoys all those pure benefits and pleasures which the arts slowly and partially realize from age to age. The winds which fan his cheek waft him the sum of that profit and happiness which their lagging inventions supply.
    Henry David Thoreau (1817–1862)

    Writing fiction has developed in me an abiding respect for the unknown in a human lifetime and a sense of where to look for the threads, how to follow, how to connect, find in the thick of the tangle what clear line persists. The strands are all there: to the memory nothing is ever really lost.
    Eudora Welty (b. 1909)