Examples
The following DNA sequences illustrate pair double-stranded patterns. By convention, the top strand is written from the 5' end to the 3' end; thus, the bottom strand is written 3' to 5'.
- A base-paired DNA sequence:
ATCGATTGAGCTCTAGCGTAGCTAACTCGAGATCGC
- The corresponding RNA sequence, in which uracil is substituted for thymine where uracil takes its place in the RNA strand:
AUCGAUUGAGCUCUAGCGUAGCUAACUCGAGAUCGC
Read more about this topic: Base Pair
Famous quotes containing the word examples:
“It is hardly to be believed how spiritual reflections when mixed with a little physics can hold people’s attention and give them a livelier idea of God than do the often ill-applied examples of his wrath.”
—G.C. (Georg Christoph)
“There are many examples of women that have excelled in learning, and even in war, but this is no reason we should bring ‘em all up to Latin and Greek or else military discipline, instead of needle-work and housewifry.”
—Bernard Mandeville (1670–1733)
“In the examples that I here bring in of what I have [read], heard, done or said, I have refrained from daring to alter even the smallest and most indifferent circumstances. My conscience falsifies not an iota; for my knowledge I cannot answer.”
—Michel de Montaigne (1533–1592)